ORBIT: Oligo Design

Oligo design principles

One advantage of ORBIT over other methods (e.g. CRISPR w/ gRNAs) is that the oligo design is straightforward and not much more complex than designing primers. Simply, homology arms flanking the attB site are what make an ORBIT targeting oligo. The only tricky part of oligo design is that the oligo should target the lagging DNA strand, which we and others have shown is necessary for high efficiency recombineering.

Target the lagging DNA strand

If you are working with E. coli MG1655 then we recommend you use the targeting oligo design app, which will automagically find the lagging strand and design the oligo for your gene / region of interest. If you are working with a different strain, then at a minimum you will need to know the genomic coordinates for your region of interest and the origin of replication (ori) and the total length of the genome. The ori is often right at the start of the genome file, but this is not guaranteed and is not true for E. coli MG1655. If the ori is not annotated, you may need to do some detective work to find it (there are online tools).

With the ori and genome length you can infer the replichores by assuming the replication terminus (ter) lies exactly opposite the origin (again not strictly true, but a reasonable approximation - feel free to do something more sophisticated to find ter). For example, if the ori starts at 1 and the genome is 4 Mb, assume ter lies at 2 Mb. If ori starts at 3 Mb, then assume ter lies at 1 Mb. Replichore 1 will be the segment to the right or greater than the ori position. Replichore 2 will be the segment to the left or less than the ori position.

For replichore 1, the leading DNA strand will be synthesized against the '-' strand, therefore the leading strand sequence will be the '+' direction. The lagging strand is the opposite, synthesized against the '+' strand it will therefore be '-' direction. So, for all genomic coordinates within replichore 1, use the '-' strand sequence for the targeting oligo and that will bind the template of the newly forming lagging strand. For replichore 2, it is the opposite and you should use the '+' strand sequence for your targeting oligo to bind the template of the lagging strand.

Account for the attB direction

Besides the lagging strand, the direction of the attB site should be taken into account. Bxb-1 integration is directional and ORBIT integrations should therefore only occur in one orientation. We have defined the "forward" and "reverse" attB sequence as follows:

attB fwd: 5' ggcttgtcgacgacggcggtctccgtcgtcaggatcat 3'

attB rev: 5' atgatcctgacgacggagaccgccgtcgtcgacaagcc 3'

Conventionally, when deleting a gene or integrating near a gene, we choose attB to go in the same direction as the gene. This gives a consistent expectation for how the final ORBIT integration will occur. Of course, this is not strictly required, it is mostly to avoid confusion and establish a convention. However, this process can be confusing when accounting for both attB direction and the lagging strand. The table and figure below show how to design the actual 5' to 3' targeting oligo to achieve integrations in either or orientation on either replichore.

The targeting oligo design app does this automatically.

Oligo ordering options

We have successfully used oligos from 90 nt to 128 nt. Typically we order these with no additional purification (desalted only). Although PAGE purification can improve efficiency, it is expensive and not usually necessary. We have successfully used oligos from IDT, Millipore Sigma, SynBioTech and Twist Biosciences. It seems likely that many different commercial sources will work fine for ORBIT. 

For those that have never ordered long oligos, it is often necessary to order a larger prep size than for PCR primers. For example, IDT requires 100 nmole preps for a 90 nt and Millipore Sigma requires 0.05 µmole preps for 90-120 nt oligos. Again, we typically select no additional purification - desalting only.

For our lab, oligos 90, 100, or 120 nt are available from IDT and cost $16, $42, or $82 respectively. Oligos 90 - 120 nt are available from Millipore Sigma and cost $18-24 (UTSW 2023 pricing). In general, the longer the homology arms, the more efficient ORBIT will be, so we typically use 120 nt oligos from Millipore Sigma, although IDT oligos of the same length (i.e. both 90 nt) tend to be a bit more efficient.

TO design app

We developed a simple web app to simplify the targeting oligo design process. There are instructions on the app, but briefly it can be thought of a lightweight genome browswer for the E. coli MG1655 genome. The easiest way to navigate is by selecting a gene from the dropdown menu (typing brings up matching gene names). When a gene is selected, either in the drop down, or by clicking on the gene arrow (highlights red), a targeting oligo is instantly designed according to the paramers on the left hand side. The attB direction will be automatically selected to match the gene and the resulting targeting oligo sequence will account for that and the lagging strand.

The targeting oligo can be set to target any genomic position manually by using the text boxes on the bottom (TO Left / Right). Then the TO sequence can be copied to the user clipboard by clicking the button. It is also possible to "save" or "share" a given TO or app view by clicking "copy TO params to link." This will store the parameters in a long link that the app automatically parses when the user navigates to it.

Flanking genomic sequence can also be displayed alongside the TO to faciliate designing colony PCR primers. We recommend checking your ORBIT TO manually with a DNA editor, like Benchling. It can very instructive to see what final modification your TO will actually result in.

In the future, we may extend this app to work with any available bacterial genome. Please let us know if you're interested in this! In the meantime, TOs can be designed manually, or with a bit of coding knowledge you could change this app to work with a different genome. The source code is available on github.